| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.053545 |
| Chromosome: | plastome |
| Location: | 79963 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| CreCp.g802297 | psbB,2717002,ChreCp032 | (1 of 1) K02704 - photosystem II CP47 chlorophyll apoprotein (psbB); photosystem II P680 chlorophyll A apoprotein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATGAAGCACCTTCAGCTAAACTAGCTTGTACACGTTTTTGAATTTCTT |
| Internal bar code: | GCCGTGTGAGAAAGCTTCTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 133 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGGGCAGGTTCTATGGCT |
| Suggested primer 2: | ACGTCACGGAAGATCGTACG |