Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.053583 |
Chromosome: | chromosome 4 |
Location: | 523364 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g217931 | P4H14,PFH14 | Prolyl 4-hydroxylase 14; (1 of 2) IPR003582//IPR005123//IPR006620//IPR027450 - ShKT domain // Oxoglutarate/iron-dependent dioxygenase // Prolyl 4-hydroxylase, alpha subunit // Alpha-ketoglutarate-dependent dioxygenase AlkB-like | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAGAGAGGAATGTCCTTGCAATGTCGCGAACTCAAGTAAGGATTGCGT |
Internal bar code: | ATAGATTCGTTTATAGGGGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1604 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCCCTCTTCTACGCCAAA |
Suggested primer 2: | CATGTGGACACTGTTGTGCG |