Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.053585 |
Chromosome: | chromosome 3 |
Location: | 8858130 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g205809 | (1 of 1) PF01367//PF02739 - 5'-3' exonuclease, C-terminal SAM fold (5_3_exonuc) // 5'-3' exonuclease, N-terminal resolvase-like domain (5_3_exonuc_N) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTCGCGCGGCGACAGCAGTTGGCAGGACGCCTTGCCGGTCGCTCGGCC |
Internal bar code: | CAGTAAGTTCTAAACTAGTATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2128 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 39 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCATCGTTGGAATGCTGG |
Suggested primer 2: | CCCATCCACCTATGCCCATC |