| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.053606 |
| Chromosome: | chromosome 1 |
| Location: | 1690487 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g009325 | (1 of 2) 1.14.11.18 - Phytanoyl-CoA dioxygenase / Phytanoyl-CoA hydroxylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAAGGTAACGCCTACACGGCAATCCCTACGACGCGCCCGCGAGTGCCCTC |
| Internal bar code: | CAGCGCGATCTTTGTAGCTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 625 |
| LEAP-Seq percent confirming: | 15.7895 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTGGTGAGTGTTGCACATG |
| Suggested primer 2: | CGCGAATTTCCCGTTGATCC |