| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.053700 |
| Chromosome: | chromosome 12 |
| Location: | 5913036 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533700 | CYA12 | Solute-binding protein-like adenylate cyclase; (1 of 3) IPR000104//IPR001054//IPR006059//IPR029787 - Antifreeze protein, type I // Adenylyl cyclase class-3/4/guanylyl cyclase // Solute-binding family 1 // Nucleotide cyclase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGTTGCCTTGCTGAGCTGGTTCTGCAACTGTTACTGTGTAGACTGCTT |
| Internal bar code: | TGTCTTCAGTGGGTCATCTTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1195 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 8 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTTGCGCACCATGGAAAAG |
| Suggested primer 2: | TGTTGGATGGTCATCTGGCC |