| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.053775 |
| Chromosome: | chromosome 12 |
| Location: | 5288894 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g528100 | CPZ | Zinc carboxypeptidase; (1 of 1) PTHR12756:SF12 - CYTOSOLIC CARBOXYPEPTIDASE-LIKE PROTEIN 5 | 3'UTR |
| Cre12.g528150 | OST3 | (1 of 2) PF04756 - OST3 / OST6 family (OST3_OST6); Oligosaccharyl transferase complex subunit 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGTTTCTACTCTGCTTGCAGGGGCTTCTTTCTTACGCTGCTGTCCTGG |
| Internal bar code: | ATGGGCGGGGCATTATAATCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3382 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 43 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACAGCAGGAATGGAACCC |
| Suggested primer 2: | AGTCAGGCTATCAGGAGGCA |