| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.053780 |
| Chromosome: | chromosome 6 |
| Location: | 8441827 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g308400 | PTN1 | (1 of 1) 3.1.3.16//3.1.3.48//3.1.3.67 - Protein-serine/threonine phosphatase / Serine/threonine specific protein phosphatase // Protein-tyrosine-phosphatase / PTPase // Phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase / Phosphatidylinositol-3,4,5-trisphosphate 3-phosphohydrolase; PTEN PI-3 phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCTCGGGTCGTCGCTTCCGCAGCGCCTTTGCCAGTTTGTCCAGCTGCGC |
| Internal bar code: | GGAGTAACCGTGAGTGTTCAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1873 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGCCGGAACTCATCATAGA |
| Suggested primer 2: | CTCTTCACATGCATGCGCTC |