Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | + |
Strain: | CLIP2.053885 |
Chromosome: | chromosome 7 |
Location: | 2335067 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g328150 | PDI4 | Protein disulfide isomerase 4; (1 of 1) PTHR18929:SF38 - PROTEIN DISULFIDE-ISOMERASE A6 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGGGCAGGAAGGCGATGATGCACATGCGCTTGGGCTTGGCGCCGGAC |
Internal bar code: | TGGCACCTCTGATTAATGTAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1046 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGAAATGGAAGGGGAGGGC |
Suggested primer 2: | CATGCTGGTGCCATTCGATG |