Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.053934 |
Chromosome: | chromosome 3 |
Location: | 1536202 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g152000 | ABA3,MCS1 | (1 of 2) K15631 - molybdenum cofactor sulfurtransferase (ABA3); Molybdenum cofactor sulfurase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCACCCGGCCGCCGCGCCGCCGGTACTGCGCCAGCGCCACCAGCACCT |
Internal bar code: | GCAGAGAGGTACATGAGAATGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 398 |
LEAP-Seq percent confirming: | 85.1852 |
LEAP-Seq n confirming: | 23 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGAACACCGCTGCTGATTCT |
Suggested primer 2: | GAGCCTCTTCCCAACCTTCC |