Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.053949 |
Chromosome: | chromosome 10 |
Location: | 5068141 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g455000 | (1 of 1) IPR010995//IPR011009 - DNA repair Rad51/transcription factor NusA, alpha-helical // Protein kinase-like domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAAGCGGCACCAGAGACCGCGTCGCCTGGGCCTGTAACGCATCGAAACGT |
Internal bar code: | GTGACTTTGTGTAGATAGGCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3583 |
LEAP-Seq percent confirming: | 98.0 |
LEAP-Seq n confirming: | 98 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 100 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCTCCTTTCCGCTCTCAA |
Suggested primer 2: | AGGTTAACACACGCGCAAAC |