| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.053954 |
| Chromosome: | chromosome 17 |
| Location: | 1211303 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g802036 | (1 of 2) IPR002048//IPR003117 - EF-hand domain // cAMP-dependent protein kinase regulatory subunit, dimerization-anchoring domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGAATGTGAAGGTCGCGGGGACAGCACCCCTCATCAACGAGCAGGACT |
| Internal bar code: | CTGGCTCATAGTATATTGTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3543 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 48 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCAAACTTAGCCACGCAC |
| Suggested primer 2: | TAACACCTGCAGCAAAACGC |