| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.053991 |
| Chromosome: | chromosome 2 |
| Location: | 6448593 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g388550 | bL21m,MRPL21 | Mitochondrial ribosomal protein L21; (1 of 1) K02888 - large subunit ribosomal protein L21 (RP-L21, MRPL21, rplU) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCAGGAAGGCTGGTGGCGGCAGGGTTGTAGAGTTTGCGCAGCGCGAG |
| Internal bar code: | TTTGTCGCGACGGTTTTAGTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 180 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCTCGCAGTACAAGGTAC |
| Suggested primer 2: | GTCTCTAGGGACCTGGCTCA |