Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.054152 |
Chromosome: | chromosome 16 |
Location: | 6217214 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676650 | AP1G1 | Gamma1-Adaptin; (1 of 1) K12391 - AP-1 complex subunit gamma-1 (AP1G1) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGGCCCGCCCTCATGCGTACCTAGCCCCTTGACCCCATACCCCCGCCC |
Internal bar code: | TAACGAATTGACCCTTGAAGTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1057 |
LEAP-Seq percent confirming: | 16.6667 |
LEAP-Seq n confirming: | 3 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGTCTCTATCGGCATCGGC |
Suggested primer 2: | GTGCTCCAGCTCCACAATCT |