Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.054193 |
Chromosome: | chromosome 16 |
Location: | 5218581 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g684550 | HAR2 | Possible 3-hydroxyacid dehydrogenase; (1 of 3) 1.1.1.26 - Glyoxylate reductase / NADH-dependent glyoxylate reductase | 5'UTR |
Cre16.g684600 | SEC5 | (1 of 1) K17637 - exocyst complex component 2 (EXOC2, SEC5); Component of the Exocyst Complex | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTTTTATAAACAGAGTATTTGATTGAAAGCGGCAACACTCCAGCGCTT |
Internal bar code: | GTCGCCCATCCACCGTCGGCGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1224 |
LEAP-Seq percent confirming: | 43.4783 |
LEAP-Seq n confirming: | 10 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTGGCAGCTGGAAAGCTAC |
Suggested primer 2: | GTGAGCGATGCAATGAGCTG |