| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.054276 |
| Chromosome: | chromosome 11 |
| Location: | 4043080 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g480700 | (1 of 2) IPR000104//IPR000945 - Antifreeze protein, type I // Dopamine beta-hydroxylase-related | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCCATCAGCGCGCACGGCTGTAGCAACCCCTGGTTCACCCTCATCTT |
| Internal bar code: | ACGCTTTTTGTAAAGGAAAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 698 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAGGGTGGGGTAGATGGAG |
| Suggested primer 2: | GAGTGTGTGTGTAGGGTGGG |