Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.054316 |
Chromosome: | chromosome 8 |
Location: | 1256381 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g363650 | (1 of 5) IPR000104//IPR016024 - Antifreeze protein, type I // Armadillo-type fold | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGTATACCGTACCGTGTGCTCTTATGCATTTGGCGAGCAGGTGCGTGT |
Internal bar code: | AGGATAACCCCAGATTCCTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1014 |
LEAP-Seq percent confirming: | 12.9032 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTATCTTCACCCACTCCCG |
Suggested primer 2: | CTTGAAATGCACCCAACGCA |