| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.054318 |
| Chromosome: | chromosome 14 |
| Location: | 1588152 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g618400 | ABCA3 | (1 of 4) 3.6.3.29 - Molybdate-transporting ATPase; ABC transporter 3 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGCACTGTTTTGGGTCGAAGGGAGGCATTGGGAGAGCGTGTGGGTCAG |
| Internal bar code: | AGATAGAGTACCGTGCTTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 678 |
| LEAP-Seq percent confirming: | 4.05405 |
| LEAP-Seq n confirming: | 3 |
| LEAP-Seq n nonconfirming: | 71 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACTGCTAGTGGCGTCAAGAC |
| Suggested primer 2: | CAAATGTGAAGCCCCACTGC |