Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.054408 |
Chromosome: | chromosome 17 |
Location: | 2858035 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g718750 | FAP309 | EF-Hand Containing Flagellar Associated Protein 309; (1 of 1) IPR001763//IPR002048//IPR011992 - Rhodanese-like domain // EF-hand domain // EF-hand domain pair | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTTTCCCTTCCATTTCTTCTTTTCATCGCACCTGCCACTGCTCTGACC |
Internal bar code: | TACATGGGCAGCGTTATCTATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 58 |
LEAP-Seq percent confirming: | 66.6667 |
LEAP-Seq n confirming: | 4 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGAGTTCAGGCGTGAAGG |
Suggested primer 2: | ATCAAGACCCAGAGCAAGCC |