| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.054431 |
| Chromosome: | chromosome 2 |
| Location: | 2749285 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g093850 | (1 of 1) IPR000104//IPR000595//IPR001611//IPR003591//IPR018490 - Antifreeze protein, type I // Cyclic nucleotide-binding domain // Leucine-rich repeat // Leucine-rich repeat, typical subtype // Cyclic nucleotide-binding-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGACGAGTGATGGTGGCAAGGAACAGGAAACAAGCATGCAAGGACTAC |
| Internal bar code: | CTTTTAAAAGCTCATTCAGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4292 |
| LEAP-Seq percent confirming: | 74.3243 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 74 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAGCGGGAGTCAAGGGAT |
| Suggested primer 2: | GACCTCAACACAGCTCACGA |