| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.054493 |
| Chromosome: | chromosome 9 |
| Location: | 2420760 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393600 | (1 of 1) K10735 - GINS complex subunit 4 (GINS4, SLD5) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATGACTCACTGGCGTTGGAGCTCCTGCTTGTCCAGGATGAGCGTGGC |
| Internal bar code: | CTTCATTATTGGTACGGCACTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2499 |
| LEAP-Seq percent confirming: | 97.8261 |
| LEAP-Seq n confirming: | 45 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 46 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGTCCACTACACGCTGT |
| Suggested primer 2: | GGGGTGAGGAGGTAGGTCAT |