Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.054503 |
Chromosome: | chromosome 13 |
Location: | 4053586 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g590750 | HTB21,HTB37 | (1 of 27) K11252 - histone H2B (H2B); Histone H2B | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGCGTTTAAACATTTGGCCCGCGATGGTACGAGGCTCAAGTGTGCCATA |
Internal bar code: | CAACTTAGGCACAGTTACTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 5377 |
LEAP-Seq percent confirming: | 68.1416 |
LEAP-Seq n confirming: | 77 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 113 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTGCCCTTCTTCAGGTAGCG |
Suggested primer 2: | AGTCTGGATCTGGGTCTCCC |