Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.054519 |
Chromosome: | chromosome 7 |
Location: | 591432 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g316650 | (1 of 1) PF00069//PF03924//PF07714 - Protein kinase domain (Pkinase) // CHASE domain (CHASE) // Protein tyrosine kinase (Pkinase_Tyr) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATGGCCATGTGCAATGGGATGCAGCTGCGGCCGCCGTGCGTCCAGGCCG |
Internal bar code: | CCTGATAAATATGGAAATCCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3531 |
LEAP-Seq percent confirming: | 84.6939 |
LEAP-Seq n confirming: | 83 |
LEAP-Seq n nonconfirming: | 15 |
LEAP-Seq n unique pos: | 98 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCGCAGAGCTCTCTCTCACT |
Suggested primer 2: | GATTCCCTGCACTGGTCACA |