Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.054548 |
Chromosome: | chromosome 6 |
Location: | 8508354 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g309150 | ROC56 | (1 of 1) K13220 - WW domain-binding protein 4 (WBP4, FBP21) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAGTGCGCCGACGGAAGTGTTGGGCAAAGCGAAGAAGCGAACTCGCCC |
Internal bar code: | GCCAATCAACTGGCCCTAGAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2576 |
LEAP-Seq percent confirming: | 77.193 |
LEAP-Seq n confirming: | 44 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCCCCTTGATTAACAGCCT |
Suggested primer 2: | TTCAGAAGCTGTGGAGGCAG |