| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.054550 |
| Chromosome: | chromosome 12 |
| Location: | 240068 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g485100 | FAP326 | Flagellar Associated Protein 326; (1 of 2) PTHR20899//PTHR20899:SF1 - UNCHARACTERIZED // UPF0691 PROTEIN C9ORF116 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCGCACCAACTTGACCGCACCCGCCAAAGAGCCGCCGGCCATAGTGC |
| Internal bar code: | GCTATGTTTAATTGGTCTAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3939 |
| LEAP-Seq percent confirming: | 76.3158 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGTATCTGCGAGGGCGAA |
| Suggested primer 2: | CCCTAGTTCTGCTTGTGGGG |