Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.054615 |
Chromosome: | chromosome 12 |
Location: | 5792380 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g532850 | PHR3 | (1 of 4) PF00497 - Bacterial extracellular solute-binding proteins, family 3 (SBP_bac_3); Putative photolyase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTGACGCGAGTGCCGAGACGCGAACAGTGACGCGAACTACTTTGAAGG |
Internal bar code: | AGTCGAAGAACTGCTCGTAGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2822 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 51 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 54 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTCGGCCGACTGATTATCA |
Suggested primer 2: | GCACAACATGAACACACGCT |