Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.054634 |
Chromosome: | chromosome 16 |
Location: | 3717212 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g681657 | (1 of 1) PF01344//PF13415//PF13418 - Kelch motif (Kelch_1) // Galactose oxidase, central domain (Kelch_3) // Galactose oxidase, central domain (Kelch_4) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCAAATCAGGTGGGCTTAGCCGCCCATCATCACGACCGCGTTCAAATCT |
Internal bar code: | TATGATTTATACAGAAATTTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2329 |
LEAP-Seq percent confirming: | 25.4237 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 44 |
LEAP-Seq n unique pos: | 59 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACACGTAAAGCCTGTGGAGG |
Suggested primer 2: | GCCACTTGCGCTTGAAGAAA |