| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.054776 |
| Chromosome: | chromosome 14 |
| Location: | 3925575 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632791 | (1 of 1) K10768 - alkylated DNA repair protein alkB homolog 6 (ALKBH6) | intron | |
| Cre14.g632799 | ZSP2A | (1 of 31) IPR016187 - C-type lectin fold; ZSP2A, hydroxyproline-rich glycoprotein with lectin-like repeats | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGCGGGACAACCCATGTCAACACACACGCGCCATCGGCCAGGGCTTG |
| Internal bar code: | TTCTTCGCGTATGACGTTTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 467 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 13 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCTGTCTGTGTGTGCCCAG |
| Suggested primer 2: | CGCCATGACTTCACTCACCT |