| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.054788 |
| Chromosome: | chromosome 1 |
| Location: | 2290144 |
| Confidence (%): | 40 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g012750 | KCN7 | (1 of 4) IPR000595//IPR002110//IPR005821//IPR018490//IPR020683 - Cyclic nucleotide-binding domain // Ankyrin repeat // Ion transport domain // Cyclic nucleotide-binding-like // Ankyrin repeat-containing domain; Voltage-gated potassium channel | outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGGTTGGGCGAAATGGCTAAGTGCGAGCGCGTACCGTACTGCTATGGA |
| Internal bar code: | TGAGTGCGGAATGCTTCAAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 837 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCTCGAAGGCGTCAACTG |
| Suggested primer 2: | AACACCTGTTGCATTGCGTC |