| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.054821 |
| Chromosome: | chromosome 2 |
| Location: | 1537873 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g084450 | PFH10,PHX5,P4H-10 | Prolyl 4-hydroxylase 10; (1 of 14) K00472 - prolyl 4-hydroxylase (E1.14.11.2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTGCGTCCATGCACACCGGCTGCCCGGTGATCAAGGGCGTGAAGTGGG |
| Internal bar code: | GAGCTAATCTCGTAGAAATTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2725 |
| LEAP-Seq percent confirming: | 99.5575 |
| LEAP-Seq n confirming: | 225 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 226 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCGCTTTCTCTACGCCTAG |
| Suggested primer 2: | TCCGCACTAGCTATGGCATG |