| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.054838 |
| Chromosome: | chromosome 12 |
| Location: | 4018468 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g516050 | (1 of 1) PF00498//PF13920 - FHA domain (FHA) // Zinc finger, C3HC4 type (RING finger) (zf-C3HC4_3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGAATGTGCGCGACACGAAGAGACGTTGTAGTCGCTAGCACGCATAGAA |
| Internal bar code: | AGTGGTGATAAAGTATTCCGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2359 |
| LEAP-Seq percent confirming: | 91.6667 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTGGTTGTGCAGTTGACTG |
| Suggested primer 2: | TGGCACAAAAGCAATCCTGC |