| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.054851 |
| Chromosome: | chromosome 10 |
| Location: | 3427789 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g444150 | (1 of 2) IPR007743//IPR027417//IPR030385 - Immunity-related GTPases-like // P-loop containing nucleoside triphosphate hydrolase // IRG-type guanine nucleotide-binding (G) domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAAGTGCGTGCGAGGGCACGTGGTATGAGACGAAGCTGCCAATGTGAG |
| Internal bar code: | GCGGTCAGTCACATACGTATCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 286 |
| LEAP-Seq percent confirming: | 2.38095 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGGACTGGAGGACCCATA |
| Suggested primer 2: | AGTTCGTCCCATTCACGGAC |