| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.054874 |
| Chromosome: | chromosome 7 |
| Location: | 1087415 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g320200 | (1 of 1) PTHR23244:SF208 - F14M2.9 PROTEIN-RELATED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGCTCGCTCGCCCGCTCGCTCGCTCTGTTGCCTGCGCGTACAGCCACA |
| Internal bar code: | GTAAGCGTGAACGTAGGTAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2226 |
| LEAP-Seq percent confirming: | 48.7179 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTTACCGTCACAGGGAGCA |
| Suggested primer 2: | CGAGTAGGTGACCTCCAGGA |