| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.054901 |
| Chromosome: | chromosome 12 |
| Location: | 9292761 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g542450 | (1 of 1) K18422 - helicase MOV-10 [EC:3.6.4.13] (MOV10); ATP-dependent DNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCTGAAGCAGCTACGGTGATTACGCGCATGTGCACGTGTCGAAAGCAA |
| Internal bar code: | ACGGGTCGTAGTGTCGGCCATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 705 |
| LEAP-Seq percent confirming: | 85.1852 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACCCATGATTCACCTGCT |
| Suggested primer 2: | AGCAGCACGGGAGAAAATGA |