| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.054910 |
| Chromosome: | chromosome 2 |
| Location: | 5716336 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g116400 | FAP120,DII7 | Flagellar Associated Protein 120; (1 of 78) IPR002110//IPR020683 - Ankyrin repeat // Ankyrin repeat-containing domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACACACACACGCCCTCGCTCCTCCCTGCTACCCGCTCCCCACCAGTCCGG |
| Internal bar code: | GACCTATAACGGGTTAATAGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 113 |
| LEAP-Seq percent confirming: | 1.88679 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTCCGCTTGCGCTATCTA |
| Suggested primer 2: | GACGGGGAAGAGCAACTTGA |