| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.054978 |
| Chromosome: | chromosome 2 |
| Location: | 5347970 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g113400 | PACRG1,PACRG,BUG21 | Parkin Co-Regulated Gene Protein; (1 of 1) PTHR21207:SF2 - PARKIN COREGULATED GENE PROTEIN | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTTGCGGTACGTGGACGTGAAGAGGCTGCCCGCCACGTCTCCGTTCAT |
| Internal bar code: | CATTTTTTTTGTAAATTCGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2230 |
| LEAP-Seq percent confirming: | 89.4737 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTATGCGCTTGTACTGTGC |
| Suggested primer 2: | CAGTGAAGTGTAGGGCTGGG |