| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.055011 |
| Chromosome: | chromosome 8 |
| Location: | 185875 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g800885 | (1 of 2) PF13875 - Domain of unknown function (DUF4202) (DUF4202) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTCCTCCGTTACACACCCATGCTCCTGCATCCCTTGTGCTACTGCCTCC |
| Internal bar code: | GTTATCGTGACTTTTCATGTTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2109 |
| LEAP-Seq percent confirming: | 77.2727 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGACCTACCCCTCCTAACC |
| Suggested primer 2: | TCCACGTTCCATACCCTCCT |