| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.055115 |
| Chromosome: | chromosome 14 |
| Location: | 1085311 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g614500 | BTB/POZ domain containing protein; (1 of 25) IPR000210//IPR011333 - BTB/POZ domain // POZ domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGGAGAACGCGTCAGGCGGCGTTGAACTCCGCAGGTTGGTGCACGGC |
| Internal bar code: | GCCAGGACGTCGACCGGAAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1362 |
| LEAP-Seq percent confirming: | 85.7143 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAGCGTCATCAGTGTGGTT |
| Suggested primer 2: | CGGTTTTGCATGTCGTCGTT |