Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.055164 |
Chromosome: | chromosome 8 |
Location: | 694104 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre08.g360500 | ERM2 | (1 of 1) PF13967//PF14703 - Late exocytosis, associated with Golgi transport (RSN1_TM) // Cytosolic domain of 10TM putative phosphate transporter (PHM7_cyt); ERD4-related membrane protein | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTGGTGAGAGCCGCGCAACAACGCCCCCGGCTGGGCTCTTAGGGGAGG |
Internal bar code: | TGCATGCAGGATTTATTGGTAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 748 |
LEAP-Seq percent confirming: | 71.4286 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCCAACAGTCGTGACGTTA |
Suggested primer 2: | TACATGCGCATCCTGTGGTT |