| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.055208 |
| Chromosome: | chromosome 2 |
| Location: | 6699234 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g387245 | STT3A | Staurosporin and temperature sensitive 3-like A; (1 of 1) PTHR13872//PTHR13872:SF1 - 60S RIBOSOMAL PROTEIN L35 // DOLICHYL-DIPHOSPHOOLIGOSACCHARIDE--PROTEIN GLYCOSYLTRANSFERASE SUBUNIT STT3B | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGAATGCGGTACATGGAACCCGCAGTGAAGATGAGGCCCTGAGAAGAA |
| Internal bar code: | TCGGCGCGGAGGCAATGACCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1997 |
| LEAP-Seq percent confirming: | 82.1429 |
| LEAP-Seq n confirming: | 46 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGATCGGACATGGTACCC |
| Suggested primer 2: | GGCTGGTATGTACAACCCCC |