| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.055270 |
| Chromosome: | chromosome 6 |
| Location: | 1467279 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g260400 | FAP287 | (1 of 1) PF13881 - Ubiquitin-2 like Rad60 SUMO-like (Rad60-SLD_2); Ubiquitin-like Flagellar Associated Protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGAGGGCGGGCTTGCCGGTGGTCACTGAACTGCCCCTGACCATGTCTGG |
| Internal bar code: | TATGAAAATGGTGCAGGATGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2847 |
| LEAP-Seq percent confirming: | 85.2941 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCATGCACTCTGTCCTGTT |
| Suggested primer 2: | AGTGGGAGCTTCCGAAGTTG |