| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.055296 |
| Chromosome: | chromosome 13 |
| Location: | 2303323 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g578800 | LYR5 | Complex 1 protein (LYR family); (1 of 3) IPR008011//IPR026868 - Complex 1 LYR protein // LYR motif-containing protein 2 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCGGCCTGTTCGGCACACAAGGGTTCAGTGCCTCGAACCAGTACGGGC |
| Internal bar code: | CGGTTCTACAAATTTTTGTGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1654 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCGGCCTTCACAACACAAC |
| Suggested primer 2: | CACCTTGCACTTGAGCACAC |