Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.055330 |
Chromosome: | chromosome 1 |
Location: | 4592293 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g031700 | FKM1 | DNA methylase in the FkbM family; (1 of 13) PF05050 - Methyltransferase FkbM domain (Methyltransf_21) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAATGCAACAGAGCGAGGAGGAGAGCGTGGCCTATGCTTTGGCAACGGAG |
Internal bar code: | GTTGGGGAAGGGTTGTGAGTCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1385 |
LEAP-Seq percent confirming: | 89.4737 |
LEAP-Seq n confirming: | 34 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCTTCCCTTCACACGCCTC |
Suggested primer 2: | ACCTGTCCATGATGGCCTTG |