Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.055439 |
Chromosome: | chromosome 3 |
Location: | 3620759 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g168200 | C1b-135,FAP69 | Flagellar Associated Protein 69; (1 of 4) IPR000225//IPR011989//IPR016024 - Armadillo // Armadillo-like helical // Armadillo-type fold | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCAACCGCCGCCGTGCCCGCTAGCACCACTCTTGCCTGTGGAATGACG |
Internal bar code: | TGTAGCCGCTTATCGAAACCGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 623 |
LEAP-Seq percent confirming: | 38.8889 |
LEAP-Seq n confirming: | 7 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCTGTAGCAGGGAAGGTA |
Suggested primer 2: | CAGAACCGCAACAACTTGGG |