| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.055539 |
| Chromosome: | chromosome 16 |
| Location: | 566216 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g692350 | (1 of 10) PTHR23257//PTHR23257:SF520 - SERINE-THREONINE PROTEIN KINASE // IP11267P | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGAGAGCTGAGTAAAGGTACAGGACTCGACCCAGCCGCAATGATTAGCC |
| Internal bar code: | GCTTTTTATTCCGAAGTGCGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 786 |
| LEAP-Seq percent confirming: | 69.2308 |
| LEAP-Seq n confirming: | 9 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTTTGTGGACTTTCGGGC |
| Suggested primer 2: | CACAGCAACTGCAATCCACC |