Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.055561 |
Chromosome: | plastome |
Location: | 121904 |
Confidence (%): | 63 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
CreCp.g802313 | rbcL,ChreCp049,2717040 | (1 of 1) K01601 - ribulose-bisphosphate carboxylase large chain (rbcL); RuBisCO large subunit | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGGTGACCTAGAGTACCACCACCGAACTGAAGACATGCGTCATCACCGA |
Internal bar code: | CAAGTTACTGCAAGGGTGAGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 146 |
LEAP-Seq percent confirming: | 25.0 |
LEAP-Seq n confirming: | 2 |
LEAP-Seq n nonconfirming: | 6 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAACCATTCATGCGTTGGC |
Suggested primer 2: | TATACGTGCGACCCGATGTG |