| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.055590 |
| Chromosome: | chromosome 7 |
| Location: | 1820006 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g325731 | (1 of 6) PF01925 - Sulfite exporter TauE/SafE (TauE) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCGCGGTAGGAGCAGCGGCAGCGGCGGTGACGCCCACACGGTAGTGGTT |
| Internal bar code: | ATATTCTATCTTGCGATCTTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2236 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTCGCAGAAGCAAACCCG |
| Suggested primer 2: | TCCTGACCCACATGGCAATC |