| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.055634 |
| Chromosome: | chromosome 2 |
| Location: | 5656118 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g115800 | (1 of 3) PF01987 - Mitochondrial biogenesis AIM24 (AIM24) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGGGGGTGACACAGGGCCAGCAGGGCATGTACCGTACCGTACGCTTGC |
| Internal bar code: | TTAAATCCGTACGGGCTGGATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2065 |
| LEAP-Seq percent confirming: | 70.7317 |
| LEAP-Seq n confirming: | 29 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 41 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCACTCACCAATCTTCCGCT |
| Suggested primer 2: | CAGCATGGACACGGGATTCT |