| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.055787 |
| Chromosome: | chromosome 16 |
| Location: | 7971508 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g691440 | FAP43 | Flagellar Associated Protein 43; (1 of 2) PTHR14885//PTHR14885:SF1 - UNCHARACTERIZED // WD REPEAT-CONTAINING PROTEIN 96 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCCCCACGCGTGGCACGTAACCTCGGCGCCGGCCGGCAGTGCGCCCG |
| Internal bar code: | GTTTCCAAGTGGATATTCGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1716 |
| LEAP-Seq percent confirming: | 94.7368 |
| LEAP-Seq n confirming: | 18 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTGGATGATGGTGCCAAC |
| Suggested primer 2: | CCGCTGATAGCAGTAGGTCG |