| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.055797 |
| Chromosome: | chromosome 10 |
| Location: | 6406221 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g464450 | (1 of 2) PF00651//PF07707 - BTB/POZ domain (BTB) // BTB And C-terminal Kelch (BACK) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGTTCGAACACGTGCACACAGCTCATTTACGTAAACCGGGCCGTTGCG |
| Internal bar code: | TGATACTGCACCGGTTGGGACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1643 |
| LEAP-Seq percent confirming: | 84.6154 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTCAGCATCACCGTTGAC |
| Suggested primer 2: | GTTTCACGTCCCCCATCCAT |