Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.055875 |
Chromosome: | chromosome 12 |
Location: | 229722 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g484900 | FAP83 | (1 of 2) PF13879 - KIAA1430 homologue (KIAA1430); Flagellar Associated Protein 83 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAATACATCTGCAGCGCATAGTCCAAAGCAACTTCTACCTCATTTAATTA |
Internal bar code: | GTTCATGATGTAATGCGGAGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2852 |
LEAP-Seq percent confirming: | 83.3333 |
LEAP-Seq n confirming: | 5 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCTCGTCCTGCTCATACGTC |
Suggested primer 2: | CGACTCAACATATCGGCGGA |